If you have been reading about Nuclear receptor and want a single page that covers the useful parts, this is it: definitions, context, how it is studied, and the questions that come up repeatedly.
Updated 2026-07-18. Numbers and descriptions here follow the published literature rather than marketing material.
GW501516 acts as a ligand for PPAR delta, a nuclear receptor that regulates transcription of genes involved in fatty acid oxidation and energy use. Activation of this receptor in skeletal muscle shifts metabolism toward fat burning in animal models. The compound does not burn fat directly; it changes gene expression over hours to days. Researchers study it to understand metabolic flexibility and exercise adaptation. Effects observed in rodents are not automatically expected in humans.
Preclinical research reported that GW501516 increased running endurance in mice and improved lipid profiles in some animal species. Early human trials explored effects on high-density lipoprotein cholesterol, triglycerides, and glucose handling, but the program was discontinued. Published human data are sparse and do not establish efficacy for any condition. Studies also examined PPAR delta in cancer biology, with conflicting findings across models. The relationship between receptor activation, tissue context, and disease risk remains an active area of investigation.
Early clinical research explored GW501516 for lipid disorders, obesity, and diabetes. Some short-term human studies reported changes in HDL cholesterol, LDL cholesterol, and triglycerides. The development program was discontinued after rodent studies showed dose-dependent tumor formation in multiple tissues, including liver, bladder, stomach, and skin. These findings raised concerns about long-term cancer risk in humans. Because human exposure data are limited, the clinical significance of the rodent tumors remains uncertain.
Literature on cardarine often separates receptor pharmacology from toxicology. Mechanistic papers describe PPARδ activation and gene expression changes, while safety assessments focus on carcinogenicity and species differences. Questions remain about whether rodent tumors arise through PPARδ-dependent or off-target mechanisms. Another open area is how human metabolism and exposure compare with those in animal studies. Analytical methods such as liquid chromatography–mass spectrometry are used to confirm identity in biological and product samples.
| Property | Value | Notes |
|---|---|---|
| Molecular target | PPAR delta (NR1C2) | Ligand-activated nuclear receptor. |
| Primary tissues studied | Skeletal muscle, liver, adipose | Effects on fatty acid oxidation and energy use. |
| Typical detection matrix | Urine | Used in anti-doping analysis. |
| Common analytical method | LC-MS/MS | Detects parent compound and metabolites. |
| Sport regulatory class | Prohibited at all times | Listed as a metabolic modulator by WADA. |
Published studies have examined GW501516 in animal models of obesity, insulin resistance, and exercise endurance. Early human trials reportedly ended, and development was discontinued after preclinical findings raised concerns about cancer in some rodent studies. Regulatory agencies have not approved cardarine for any medical use. Its availability through non-pharmaceutical channels raises questions about identity, purity, and legal status that are separate from its laboratory pharmacology. Those questions are often addressed through analytical testing rather than assumptions about product labels.
Cardarine is a common name for GW501516, also GW-1516, a synthetic compound developed as a peroxisome proliferator-activated receptor delta (PPARδ) agonist. It belongs to a class of agents that modulate gene transcription related to lipid and energy metabolism. The compound was studied in preclinical and early clinical research for metabolic and cardiovascular conditions, but it did not progress to approved therapeutic use. Its name appears in fitness and sports contexts despite not being approved as a drug.
PPARδ is a nuclear receptor that influences transcription of genes involved in fatty acid oxidation, lipid transport, and energy homeostasis. GW501516 binds and activates this receptor with high selectivity relative to PPARα and PPARγ in laboratory assays. Activation alters expression of target genes in skeletal muscle, liver, and adipose tissue in animal models. The exact clinical consequences of these changes in humans remain incompletely characterized, and observed effects in animals do not establish therapeutic benefit or safety.
Analytical laboratories typically identify cardarine and its metabolites using liquid chromatography-tandem mass spectrometry. Urine is a common matrix in anti-doping testing, while blood and tissue may be used in research settings. Detection windows depend on the assay, the sample matrix, and the compound's metabolism. Because cardarine is extensively metabolized, laboratories often target specific metabolites to improve sensitivity and confirmation. Reference standards are required for reliable quantification. Method validation includes checks for selectivity, linearity, and carryover.
A persistent misconception is that cardarine is a fat-burning drug or a safe alternative to anabolic steroids. No approved therapeutic product exists, and human safety data are limited. The tumor findings in rodents remain a central concern in scientific reviews. Products sold online may contain inaccurate labels, impurities, or different compounds entirely, which complicates any assessment of effects. Independent testing of such products has reported frequent mislabeling. For these reasons, discussions in the literature emphasize risks and unknowns rather than benefits.
Some modern psychotherapy movements such as Re-evaluation Counseling encourage crying as beneficial to health and mental well-being. An insincere display of grief or dishonest remorse is sometimes called crocodile tears in reference to an Ancient Greek anecdote that crocodiles would pretend to weep while luring or devouring their prey. In addition, "crocodile tears syndrome" is a colloquialism for Bogorad's syndrome, an uncommon consequence of recovery from Bell's palsy in which faulty regeneration of the facial nerve causes people to shed tears while eating.
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
After presenting to an outside facility with chest pain, Sen. Sanders was diagnosed with a myocardial infarction. He was immediately transferred to Desert Springs Hospital Medical Center. The senator was stable upon arrival and taken immediately to the cardiac catheterization laboratory, at which time two stents were placed in a blocked coronary artery in a timely fashion. All other arteries were normal. His hospital course was uneventful with good expected progress. He was discharged with instructions to follow up with his personal physician. A few days after returning home, Sanders addressed media outside his home and said he had experienced fatigue and chest discomfort for a month or two before the incident; he expressed regret for not seeking medical assessment sooner, saying, "I must confess I was dumb." Sanders made his first national appearance after his heart attack on October 15 at the Democratic debate, at which he said, "I'm healthy, I'm feeling great." When asked how he would reassure voters about his health and ability to take on the duties of the presidency, he said, "We are going to be mounting a vigorous campaign all over this country. That is how I think I can reassure the American people." It was noted that he was "lively and sharp at the debate." In December 2019, three months after the heart attack, Sanders released letters from three physicians, Attending Physician of Congress Brian P. Monahan and two cardiologists, who declared Sanders healthy and recovered from his heart condition.
=== Non-covalent conjugation === Although covalent conjugation has been the dominant strategy for constructing polymer-protein hybrids, noncovalent chemistry can add another level of complexity and provides the opportunity to create higher-ordered structures. Specifically, self-assembly by non-covalent interactions is progressing rapidly. Supramolecular self-assembly can create nanoparticles, vesicles/micelles, protein cages, etc. Metal-binding interactions, host-guest, and boronic acid-based chemistries are widely studied as non-covalent conjugation methods to create polymer-protein hybrids.
Sources: en.wikipedia.org
== Criticism == The Arab Higher Committee has been criticised for not preparing the Palestinian population for the war, accepting the general expectation that Palestinian Arabs alone would not prevail over the Yishuv, and accepting the joint Arab strategy of outside Arab armies securing a prompt takeover of the country. Anwar Nusseibeh, a Palestinian nationalist who believed that the best way to advance Palestinian interest was to operate within whichever regime was in power, criticized the Arab Higher Committee's performance during the 1948 Arab–Israeli War as being unaware and ineffective at best and ambivalent at worst to the needs of the Palestinian Arab population. In a personal note, Nusseibeh wrote, "Obviously they thought of the Palestine adventure in terms of an easy walkover for the Arabs, and the only point that seemed to worry them was credit for the expected victory. ... [They] were determined that the Palestine Arabs should at all costs be excluded." The Arab community, being essentially agrarian, is loosely knit and mainly concerned with local interests. In the absence of an elective body to represent divergences of interest, it therefore shows a high degree of centralization in its political life. The Arab Higher Committee presented a 'common front' for all political parties. There was no opposition party. Decisions taken at the center. Differences of approach and interest, can be discerned, the more so from the strong pressure that is brought against them.
==== Labeling ==== For US food and dietary supplement labeling purposes, the amount in a serving is expressed as a percent of Daily Value (%DV). For selenium labeling purposes, 100% of the Daily Value was 70 μg, but as of 27 May 2016 it was revised to 55 μg. A table of the old and new adult daily values is provided at Reference Daily Intake.
=== Effectiveness === The effectiveness of chemotherapy depends on the type of cancer and the stage. The overall effectiveness ranges from being curative for some cancers, such as some leukemias, to being ineffective, such as in some brain tumors, to being needless in others, like most non-melanoma skin cancers.
DNA, RNA and proteins are most common sequence-controlled polymers in living creatures. Inspired by them, polymerization methods, utilizing DNA or RNA as templates to control sequences of polymer, are developed. At first, taking DNA or RNA as templates, scientists developed a series of peptide nucleic acid (PNA)-based polymers, without using DNA polymerases. But this method is limited to polymerization scale and yield. After that, polymerase chain reaction (PCR) is developed, which currently is still the most extensively used sequence-regulated method. By employing enzymes, the yields and scales are greatly increased, but the specificity of enzymes towards natural peptides limits this technique to a certain degree. Nowadays, more attention is paid to utilization of ribosomes to directly mimic the transcription and translation process. This technology called protein engineering is considered as the most promising biological polymerization method for synthesis of sequence-controlled polymers.
=== Pediatrics === SSRIs and SNRIs have been shown to be effective in treating major depressive disorder and anxiety in pediatric populations. However, differences in metabolism, renal function, and total percentage of body water and body fat can influence the pharmacokinetics of medications in youths as compared to adults. Additionally, there is a risk of increased suicidality in pediatric populations for treatment of major depressive disorder, especially with venlafaxine. Fluoxetine and Escitalopram are the only antidepressants that are approved for child/adolescent major depressive disorder. A literature review by Castagna, et al. from 2023 shows indications of efficacy treating pediatric generalized anxiety disorder. Currently, Duloxetine, an SNRI, is the only FDA-approved medication for pediatric GAD, despite the fact that SSRIs are typically first-line treatment. It is suggested that these medications be combined with psychotherapy to maximize effectiveness.
Sources: en.wikipedia.org
It binds to and activates PPAR delta, a nuclear receptor that controls expression of genes related to fatty acid oxidation. This mechanism can alter energy metabolism in animal models. It is not a direct stimulant or fat-burning enzyme.
Early-stage trials examined lipid and glucose markers, but the development program was discontinued. Published human results are limited and do not support approved use for any indication. Claims of performance or health benefits remain unproven.
Yes. Laboratories use LC-MS/MS to detect GW501516 and its metabolites in urine. Detection depends on timing and sensitivity, but the substance is banned at all times.
It targets PPARδ, a nuclear receptor involved in lipid and energy metabolism. It does not act primarily on androgen receptors. This distinction separates it from SARMs.